Portals
A-Z
Categories
Random
Battle of Badr
Bam Thwok
Heian Palace
Tooth development
Laplace-Runge-Lenz vector
Summer of '42
Ralph Heikkinen
Vädersolstavlan
Autobiography (Ashlee Simpson album)
Tiberius Julius Alexander
edit page
history/authors
discussion

Telomere




Human chromosomes (grey) capped by telomeres (white)
Human chromosomes (grey) capped by telomeres (white)

A telomere is a region of repetitive DNA at the end of chromosomes, which protects the end of the chromosome from destruction. Derived from the Greek telos (end) and meres (part).

During cell division, the enzymes that duplicate the chromosome and its DNA can't continue their duplication all the way to the end of the chromosome. If cells divided without telomeres, they would lose the end of their chromosomes, and the necessary information it contains. (In 1972, James Watson named this phenomenon the "end replication problem.") The telomere is a disposable buffer, which is consumed during cell division and is replenished by an enzyme, the telomerase reverse transcriptase.

This mechanism usually limits cells to a fixed number of divisions, and animal studies suggest that this is responsible for aging on the cellular level and affects lifespan. Telomeres protect a cell's chromosomes from fusing with each other or rearranging. These chromosome abnormalities can lead to cancer, so cells are normally destroyed when telomeres are consumed. Most cancer is the result of cells bypassing this destruction. Biologists speculate that this mechanism is a tradeoff between aging and cancer. [1]

Contents

[edit] Nature and function of telomeres

[edit] Telomeres and their function.

Telomeres are repetitive DNA sequences located at the termini of linear chromosomes of most eukaryotic organisms. Telomeres compensate for incomplete semi-conservative DNA replication at chromosomal ends. The protection against homologous recombination (HR) and non-homologous end joining (NHEJ) constitutes the essential “capping” role of telomeres that distinguishes them from DNA double strand breaks (DSBs) (Lundblad, 2000; Ferreira et al., 2004).

Telomere shortening in humans can induce replicative senescence which blocks cell division. This mechanism appears to prevent genomic instability and development of cancer in human aged cells by limiting the number of cell divisions. Malignant cells which bypassed this arrest become immortalized by telomere extension mostly due to the activation of telomerase, the reverse transcriptase enzyme responsible for synthesis of telomeres. However, 5-10% human cancers activate Alternative Lengthening of Telomeres (ALT) pathway which relies on telomere-telomere recombination.

Telomere length varies greatly between species, from ~300-600 bp in yeast (Shampay et al., 1984) to many kilobases in humans, and usually is comprised of arrays of 6-8 bp long G-rich repeats. Eukaryotic telomeres normally terminate with 3' ssDNA overhang which is essential for telomere maintenance and capping. Multiple proteins binding single-and double-stranded telomere DNA have been identified(Blackburn, 2001; Smogorzewska and de Lange, 2004; Cech, 2004; De Lange et al., 2005; Kota and Runge, 1999). As discussed below, these functions in both telomere maintenance and capping.

[edit] Human telomeres, cancer, and ALT.

Human somatic cells lacking telomerase gradually lose telomeric sequences as a result of incomplete replication (Counter et al., 1992). As human telomeres grow shorter, eventually cells reach the limit of their replicative capacity and progress into senescence. Senescence involves p53 and pRb pathways and leads to the arrest of cell proliferation (Campisi, 2005). It is thought that senescence plays an important role in suppression of emergence of cancer. However, further cell proliferation can be achieved by inactivation of p53 and pRb pathways. Cells entering proliferation after inactivation of p53 and pRb pathways undergo crisis. Crisis is characterized by gross chromosomal rearrangements and genome instability, and almost all cells die. Rare cells emerge from crisis immortalized through telomere elongation by either activated telomerase or ALT (Colgina and Reddel, 1999; Reddel and Bryan, 2003). ALT cells exhibit telomeres that are highly heterogeneous in length and often contain multiple telomere binding and recombination, the exact mechanism of this pathway is yet to be determined. ALT cells produce abundant t-circles, possible products of intratelomeric recombination and t-loop resolution (Cesare and Griffith, 2004; Wang et al., 2004).

Telomerase is a "ribonucleoprotein complex" composed of a protein component and an RNA primer sequence which acts to protect the terminal ends of chromosomes. This is because during replication, DNA polymerase can only synthesize DNA in a 5' to 3' direction and can only do so by adding polynucleotides to an RNA primer that has already been placed at various points along the length of the DNA. These RNA strands must later be replaced with DNA. At the terminal of the DNA strand, the RNA primer is laid but DNA polymerase cannot extend beyond it. This RNA primer will not later be replaced by DNA, and therefore cannot be translated into gene products or replicated later. Without telomeres at the end of DNA, this genetic sequence would be deleted and the chromosome would grow shorter and shorter in subsequent replications. The telomere prevents this problem by employing a different mechanism to synthesize DNA at this point, thereby preserving the sequence at the terminal of the chromosome. This prevents chromosomal fraying and prevents the ends of the chromosome from being processed as a double strand DNA break, which could lead to chromosome-to-chromosome telomere fusions. Telomeres are extended by telomerases, part of a protein subgroup of specialized reverse transcriptase enzymes known as TERT (TElomerase Reverse Transcriptases) that are involved in synthesis of telomeres in humans and many other, but not all, organisms. However, because of DNA replication mechanisms and because TERT expression is repressed in many types of human cells, the telomeres of these cells shrink a little bit every time a cell divides although in other cellular compartments which require extensive cell division, such as stem cells and certain white blood cells, TERT is expressed and telomere length is maintained.

Structure of parallel quadruplexes that can be formed by human telomeric DNA. Image created from NDB UD0017.
Structure of parallel quadruplexes that can be formed by human telomeric DNA. Image created from NDB UD0017.

In addition to its TERT protein component, telomerase also contains a piece of template RNA known as the TERC (TElomerase RNA Component) or TR (Telomerase RNA). In humans, this TERC telomere sequence is a repeating string of TTAGGG, between 3 and 20 kilobases in length. There are an additional 100-300 kilobases of telomere-associated repeats between the telomere and the rest of the chromosome. Telomere sequences vary from species to species, but generally one strand is rich in G with fewer Cs. These G-rich sequences can form four-stranded structures (G-quadruplexes), with sets of four bases held in plane and then stacked on top of each other with either a sodium or potassium ion between the planar quadruplexes.

In most prokaryotes, chromosomes are circular and thus do not have ends to suffer premature replication termination. A small fraction of bacterial chromosomes (such as those in Streptomyces and Borrelia) are linear and possess telomeres, which are very different from those of the eukaryotic chromosomes in structure and functions.

In most multicellular eukaryotes, telomerase is only active in germ cells. There are theories that the steady shortening of telomeres with each replication in somatic (body) cells may have a role in senescence and in the prevention of cancer. This is because the telomeres act as a sort of time-delay "fuse", eventually running out after a certain number of cell divisions and resulting in the eventual loss of vital genetic information from the cell's chromosome with future divisions.

If telomeres become too short, they will potentially unfold from their presumed closed structure. It is thought that the cell detects this uncapping as DNA damage and will enter cellular senescence, growth arrest or apoptosis depending on the cell's genetic background (p53 status). Uncapped telomeres also result in chromosomal fusions. Since this damage cannot be repaired in normal somatic cells, the cell may even go into apoptosis. Many aging-related diseases are linked to shortened telomeres. Organs deteriorate as more and more of their cells die off or enter cellular senescence.

At the very distal end of the telomere is a 300 bp single-stranded portion which forms the T-Loop. This loop is analogous to a 'knot' which stabilizes the telomere; preventing the telomere ends from being recognized as break points by the DNA repair machinery. Should non-homologous end joining occur at the telomeric ends, chromosomal fusion will result. The T-loop is held together by seven known proteins; most notably TRF1, TRF2, POT1, TIN1, and TIN2, collectively referred to as the shelterin complex.

A study published in the May 3, 2005 issue of the American Heart Association journal Circulation found that weight gain and increased insulin resistance were correlated with greater telomere shortening over time.

[edit] Telomere shortening

Lagging strand during DNA replication
Lagging strand during DNA replication

"Telomeres" shorten because of the end replication problem that is exhibited during DNA replication in eukaryotes only. Because DNA replication does not begin at either end of the DNA strand, but starts in the center, and considering that all DNA polymerases that have been discovered move in the 5' to 3' direction, one finds a leading and a lagging strand on the DNA molecule being replicated.

On the leading strand, DNA polymerase can make a complementary DNA strand without any difficulty because it goes from 5' to 3'. However, there is a problem going in the other direction on the lagging strand. To counter this, short sequences of RNA acting as primers attach to the lagging strand a little way ahead of where the initiation site was. The DNA polymerase can start replication at that point and go to the end of the initiation site. This causes the formation of Okazaki fragments. More RNA primers attach further on the DNA strand and DNA polymerase comes along and continues to make a new DNA strand.

Eventually, the last RNA primer attaches, and DNA polymerase and DNA ligase come along to convert the RNA (of the primers) to DNA, and seal the gaps in between the Okazaki fragments. But in order to change RNA to DNA, there must be another DNA strand in front of the RNA primer. This happens at all the sites of the lagging strand, but it doesn't happen at the end where the last RNA primer is attached. Ultimately, that RNA is destroyed by enzymes that degrade RNA left on the DNA. Thus, a section of telomeres is lost during each cycle of replication at the 5' end of lagging strand.

[edit] Lengthening telomeres

The phenomenon of limited cellular division was first observed by Leonard Hayflick, and is now referred to as the Hayflick limit. Significant discoveries were made by the team led by Professor Elizabeth Blackburn at the University of California - San Francisco.

Advocates of human life extension promote the idea of lengthening the telomeres in certain cells through temporary activation of telomerase (by drugs), or possibly permanently by gene therapy. They reason that this would extend human life. So far these ideas have not been proven in humans.

However, it has been hypothesized that there is a trade-off between cancerous tumor suppression and tissue repair capacity, in that lengthening telomeres might slow aging and in exchange increase vulnerability to cancer (Weinstein and Ciszek, 2002).

A study done with the nematode worm species Caenorhabditis elegans indicates that there is a correlation between lengthening telomeres and a longer lifespan. Two groups of worms were studied which differed in the amount of the protein HRP-1 their cells produced, resulting in telomere lengthening in the mutant worms. The worms with the longer telomeres lived 24 days on average, about 20 percent longer than the normal worms.[2]

Techniques to extend telomeres could be useful for tissue engineering, because they might permit healthy, noncancerous mammalian cells to be cultured in amounts large enough to be engineering materials for biomedical repairs.

However, there are several issues that still need to be cleared up. First, it is not even certain whether the relationship between telomeres and aging is causal. Although this is indeed probably so because changing telomere lengths are usually associated with changing speed of senescence, the relationship may well be the other way around, with telomere shortening a consequence of and not a reason for aging. That the role of telomeres is far from being understood is demonstrated by two recent studies on long-lived seabirds:

In 2003, scientists observed that the telomeres of Leach's Storm-petrel (Oceanodroma leucorhoa) seem to lengthen with chronological age, the first observed instance of such behaviour of telomeres[1]. In 2006, Juola et al.[3] reported that in another, unrelated long-lived seabird species, the Great Frigatebird (Fregata minor), telomere length did decrease until at least c.40 years of age (i.e. probably over the entire lifespan), but the speed of decrease slowed down massively with increasing ages, and that rates of telomere length decrease varied strongly between individual birds. They concluded that in this species (and probably in frigatebirds and their relatives in general), telomere length could not be used to determine a bird's age sufficiently well. Thus, it seems that there is much more variation in the behavior of telomere length than initially believed.

The telomere length varies in cloned animals. Sometimes the clones end up with shorter telomeres since the DNA has already divided countless times. Occasionally, the telomeres in a clone's DNA are longer because they get "reprogrammed". The clone's new telomeres combine with the old ones, giving it abnormally long telomeres.

Sierra Sciences, a biotechnology company in Reno, NV, has discovered a small-molecule, drug-like compound that turns on the expression of telomerase in human cells. Their scientists are presently characterizing its mechanism of action.

[edit] Telomere Length Assay

Several techniques are currently employed to assess average telomere length in eukaryotic cells. The most widely used method is the Terminal Restriction Fragment (TRF) southern blot which involves hybridization of a radioactive 32P-(TTAGGG)n oligonucleotide probe to Hinf / Rsa I digested genomic DNA embedded on a nylon membrane; and subsequently exposed to autoradiographic film or phosphoimager screen. Another histochemical method, termed Q-FISH, involves fluorescent in situ hybridization (FISH). Q-FISH, however, requires significant amounts of genomic DNA (2-20 micrograms) and labor which renders its use limited in large epidemiological studies. Some of these impediments have been overcome with a Real-Time PCR assay for telomere length and Flow-FISH. RT-PCR assay involves determining the Telomere-to-Single Copy Gene (T/S)ratio which is demonstrated to be proportional to the average telomere length in a cell. The Real-Time PCR assay has been since scaled up to high-throughput 384-well format use; making the assay feasible for use in large cohort studies. Flow-FISH is an adaptation of the Q-FISH telomere quantitation technique that uses a flow cytometer to measure median fluorescence of a population of cells, thus reducing labor requirements and increasing reproducibility. Flow-FISH has been scaled up to the 96-well format[4].

[edit] Telomere sequences

Some known telomere sequences
Group Organism Telomeric repeat (5' to 3' toward the end)
Vertebrates Human, mouse, Xenopus TTAGGG
Filamentous fungi Neurospora crassa TTAGGG
Slime moulds Physarum, Didymium TTAGGG
Dictyostelium AG(1-8)
Kinetoplastid protozoa Trypanosoma, Crithidia TTAGGG
Ciliate protozoa Tetrahymena, Glaucoma TTGGGG
Paramecium TTGGG(T/G)
Oxytricha, Stylonychia, Euplotes TTTTGGGG
Apicomplexan protozoa Plasmodium TTAGGG(T/C)
Higher plants Arabidopsis thaliana TTTAGGG
Green algae Chlamydomonas TTTTAGGG
Insects Bombyx mori TTAGG
Roundworms Ascaris lumbricoides TTAGGC
Fission yeasts Schizosaccharomyces pombe TTAC(A)(C)G(1-8)
Budding yeasts Saccharomyces cerevisiae TGTGGGTGTGGTG (from RNA template)
or G(2-3)(TG)(1-6)T (consensus)
Candida glabrata GGGGTCTGGGTGCTG
Candida albicans GGTGTACGGATGTCTAACTTCTT
Candida tropicalis GGTGTA[C/A]GGATGTCACGATCATT
Candida maltosa GGTGTACGGATGCAGACTCGCTT
Candida guillermondii GGTGTAC
Candida pseudotropicalis GGTGTACGGATTTGATTAGTTATGT
Kluyveromyces lactis GGTGTACGGATTTGATTAGGTATGT

[edit] Telomeres and cancer

Telomere maintenance activity is a hallmark in approximately 90% of cancers in almost all mammalian organisms. In humans, cancerous tumors acquire indefinite replicative capacity by over-expressing telomerase. However, a sizeable fraction of cancerous cells employ alternative lengthening of telomeres (ALT), a non-conservative telomere lengthening pathway involving the transfer of telomere tandem repeats between sister-chromatids. The mechanism by which ALT is activated is not fully understood because these exchange events are difficult to assess in vivo.

Telomerase is the natural enzyme which promotes telomere repair. It is however not active in most cells. It certainly is active though in stem cells, germ cells, hair follicles and (worryingly) in 90 percent of cancer cells. Telomerase functions by adding bases to the ends of the telomeres. As a result of this telomerase activity, these cells seem to possess a kind of immortality.

[edit] Telomeres in forensic science

A 2002 Japanese study found that an individual's age can be roughly estimated from the length of their telomeres, making it possible to determine the age of any forensic sample that contains well-preserved DNA.[5] Formerly, forensic scientists were forced to rely on morphological characteristics (such as the growth and decay of bones) to determine an individual's age.[6]

[edit] Telomeres in Pop Culture

Telomeres, and their function in the chromosome reproduction, are referred to as an integral part of the plot of the The Kindred (part 2) episode of the science fiction television series Stargate Atlantis, which first aired in the United States on February 29, 2008, on the Sci-Fi Channel.

In the anime series Gundam SEED (as well as its sequel, Mobile Suit Gundam SEED Destiny), short telomeres are the reason why clones such as Rey Za Burrel age and die faster than people of longer telomeres.

[edit] References

  1. ^ Harrison's Principles of Internal Medicine, Ch. 69, Cancer cell biology and angiogenesis, Robert G. Fenton and Dan L. Longo, p. 454.
  2. ^ Joeng KS, Song EJ, Lee KJ, Lee J (2004). "Long lifespan in worms with long telomeric DNA". Nature Genetics 36 (6): 607-11. doi:10.1038/ng1356. PMID 15122256. 
  3. ^ Juola, Frans A.; Haussmann, Mark F.; Dearborn, Donald C.; Vlek, Carol M. (2006): Telomere shortening in a long-lived marine bird: Cross-sectional analysis and test of an aging tool. Auk 123(3): 775–783. DIO: 10.1642/0004-8038(2006)123[775:TSIALM]2.0.CO;2 HTML abstract
  4. ^ Baerlocher GM, Vulto I, de Jong G, Lansdorp PM. Flow cytometry and FISH to measure the average length of telomeres (flow FISH). Nat Protoc 2006; 1:2365–2376.
  5. ^ Estimating age of humans based on telomere shorten...[Forensic Sci Int. 2002] - PubMed Result
  6. ^ Forensic Science | Forensic Anthropology

[edit] Additional reading

  • Bret Weinstein and Deborah Ciszek; The Reserve Capacity Hypothesis: A paper detailing the evolutionary origins and medical implications of the vertebrate telomere system, including the pervasive trade-off between cancer prevention and damage repair. Also addresses the probable danger posed by the elongation of telomeres in lab mice.[2]
  • Yu-Sheng Cong, Woodring E. Wright, and Jerry W. Shay; Human Telomerase and Its Regulation [3]
  • Susan Bassham, Aaron Beam, and Janis Shampay; Telomere Variation in Xenopus laevis [4]
  • Guenther Witzany (2007). Telomeres in Evolution and Development from Biosemiotic Perspective. Nature Precedings: doi:10.1038/npre.2007.932.2

[edit] External links

<span id="interwiki-ja-fa" />


Copyright © 2009. Knowledgehunter.
Other Links:
Wissen im Web
Shopping 0nline
Dictionary of Meaning